                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=72 nt.     Delta G=-18.90 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=41 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATA-TAGcat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATAGTTTTCGCTGCAAACTATAGcataatgcaatagaaagcattacctttgcggtctatgtgtaaagctaagaaggag
tccgtgaagtaaataacctttggcagtctgtcaaggttatcccttaattcatactctggcatattcttgtcagagttattttcatattctatataataag
tataatcgcatgtctataaggcggataataactatctgcaagatatacatgctcaaaaaaacaatgaaATG

    BT0758 Gene: BT0758     GI: 29346168     BI number: BT0758     GOG: COG3153     Description: acetyltransferas             t           g  c           a  t            cg            gt            gc           t  |            ta            ta            cg            cg            at            at            ta            at           |  c           |  c           |  c            at            at            ta ag       g  a a  c       at at        at ta        gc |  a       ta g  g       gt t  a      c  | g  a      c  | t  g       ta a  g       gc        tt ta        at       a  c cg        gc       t  t t  t       gt        at gc       a  |       cg gc       a  |       gt cg       g  |       gc g  t      a  |       ta t  g      a  |       cg ta        tg        ta ta        cg        cg cg        gc        at                         tattttcatattctatataataagtataatcgcatgtctataaggcggataataactatctgcaagatatacatgctcaaaaaaacaatgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3153 Predicted acetyltransferase ... can be seen here     ..................................................................................................................