Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatatgaaaccactcagaattcaataaaattgatgtaccccaaacaaaagaaaaacgttgactattattaaataatcaacgtttacatcagTGATTC
CGAAGCGATTCGAACGCTTGACCCACGCCTTAGAAGGGCGTTGCTCTATCCAGCTGAG
CTACGGAACCatccttatttgcggatgcaaaggtagtgctttttgcgagaactcaaaaacttttcgacacttttttattcatatttttcttta
tagctagaaatcagcaatttataaaagtactattcagaaccctgttctagggTTG

    BT0762


Gene: BT0762     GI: 29346172     BI number: BT0762     GOG: -------     Description: hypothetical protei


            C
          C  A
          T  G       tt
          A  C      a  t
          T  T      t  g
           CG       t  c
           TA        cg
           CG        cg
           GC        ta
          T  T       at
           TA        Cg
           GC       C  c
  G        CG       A  a
A  A      |  G      A  a
T  A      |  A      G  a
 TG       G  A      G  g
 CG        GC        Cg
 CG        GC        At
 GC       A  a       Ta
 CG        At        Cg
 AT        Gc        Gt
                        gctttttgcgagaactcaaaaacttttcgacacttttttattcatatttttctttatagctagaaatcagcaatttataaaagtactattcagaaccctgttctagggTTG
    ..................................................................................................................