                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-10.18 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCCTGAAAAAGGCTGCTCCTCTGGCAAACTCTGATGCAGACAAATATGCTGCAGAA
AAGGAAAAGGCAGATGGCAGATTTAAAGAAGCTATAGGTTACTTGGAAGAAGCTACCA
AAGTTTCTCCGGAAGATACAAAGTCTAAAACTATGCTTTCTCAAGTGCAGGCAGCTAT
GAAGTAAactaccaattccagatagaaagggttgccggggaacattttggcaacccttttttattgcttctttttttgaatgatctactttttgc
gtacttttgctttcccaaaaagaaagactttATG

    BT0767 --- BT0768 Gene: BT0767     GI: 29346177     BI number: BT0767     GOG: COG0147     Description: putative para-aminobenzoate synthase component I Gene: BT0768     GI: 29346178     BI number: BT0768     GOG: COG0115     Description: putative para-aminobenzoate synthase component   a c  a c  t a  t t  c c  c a  a A  g A  a T  t G  a A  g A  a G  a T  a A  g Tg Cg Gt        ac At       a  a Cg        gt Gc        gt Gc        gt A  g       gt C  |       cg G  |       cg T  |       gc G  |       ta A  |       ta A  |       gc Cg        gc Tg        gc Cg        at Ta        at Ta        at             tttattgcttctttttttgaatgatctactttttgcgtacttttgctttcccaaaaagaaagactttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here     ..................................................................................................................