                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:113 nt.    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.80 kcal/mol
Antiterminator:    Distance from promoter:56 nt. Size=72 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=35 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaac-tatatt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaacaaagcctctttttaatctgttatatttatgtgtttttcatagtattagataaagattaattaaaagagattgtacttcacttgtgaaagcttag
agtacatcagaagcagaagagtctgtttttttgataaatgtgttagagcatcggttttaccaggccgatgctttttttatgtccttttgttgcgttttgt
agtttatatgaaataaaatttgtacgtttgtagggtaataatagaaaatgATG

    BT0769 --- BT0770 --- BT0771 Gene: BT0769     GI: 29346179     BI number: BT0769     GOG: COG5587     Description: conserved hypothetical protein Gene: BT0770     GI: 29346180     BI number: BT0770     GOG: COG2731     Description: conserved hypothetical protein Gene: BT0771     GI: 29346181     BI number: BT0771     GOG: COG0296     Description: 1,4-alpha-glucan branching enzyme (isoamylase or pullulanase type II            ga           a  g            at            gc            at            cg            gt           |  t           |  t            at            at            gt            at            cg            ta           |  t           |  a           |  a           |  a            at            cg            at            tg aa       g  | g  a       at tg        gt gc       a  a t  t       tg t  t       ta        ac c  a       cg       t  c a  |       gc       t  a c  |      |  a       tg tg       |  t       tg ta       |  c       gc cg       |  g       gc at       |  g       cg ta        at        ta gc        at        at t  |       at        cg ta        gt        gc at        ta        at gc        gc        gt                         tttttatgtccttttgttgcgttttgtagtttatatgaaataaaatttgtacgtttgtagggtaataatagaaaatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5587 Uncharacterized conserved protein ... can be seen here [G] COG2731 Beta-galactosidase, beta subunit ... can be seen here [G] COG0296 1,4-alpha-glucan branching enzyme ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:112 nt.    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol Antiterminator:    Distance from promoter:78 nt. Size=72 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:    Distance from promoter:73 nt.    Size=30 nt.     Delta G= -7.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaac-tatatt. It has a score value of 69.61 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaacaaagcctctttttaatctgttatatttatgtgtttttcatagtattagataaagattaattaaaagagattgtacttcacttgtgaaagcttag agtacatcagaagcagaagagtctgtttttttgataaatgtgttagagcatcggttttaccaggccgatgctttttttatgtccttttgttgcgttttgt agtttatatgaaataaaatttgtacgtttgtagggtaataatagaaaatgATG     BT0769 --- BT0770 --- BT0771 Gene: BT0769     GI: 29346179     BI number: BT0769     GOG: COG5587     Description: conserved hypothetical protein Gene: BT0770     GI: 29346180     BI number: BT0770     GOG: COG2731     Description: conserved hypothetical protein Gene: BT0771     GI: 29346181     BI number: BT0771     GOG: COG0296     Description: 1,4-alpha-glucan branching enzyme (isoamylase or pullulanase type II            tg           g  t            tt            aa            ag            aa            tg           |  c           |  a            at            gc            tg            tg            tt            tt           |  t           |  t           |  a           |  c            t            t            t            g           t  |            c            t ga       g   a  g       a        ac at        g       t  c gc        a       t  a at        a        tg cg       |         tg gt       |         gc |  t      |         gc |  t      |         cg at       |         ta at        g        at gt        a        cg at        c        gc cg        g        at ta        a        gt at        a        at                         ttttatgtccttttgttgcgttttgtagtttatatgaaataaaatttgtacgtttgtagggtaataatagaaaatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5587 Uncharacterized conserved protein ... can be seen here [G] COG2731 Beta-galactosidase, beta subunit ... can be seen here [G] COG0296 1,4-alpha-glucan branching enzyme ... can be seen here     ..................................................................................................................