                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.94 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGATGGTGCTACTGATTTTACAGAATGCGGACCGGGTGCAGTATTGCAGGGATTGAT
CAAGAAAATAGATGGTACAGTAAGCGCTCACGGCATTGCATAAgcattcgtagatatactttaccttt
tctcaactatagagcgtgtcgactagtttgccgatacgctttttttatgcttattagtcaaacatgagacaattaatatgctgtaaaacacaccattagt
cttctctacgagcaaacattccgaatctttcacttgttttcattataggaatcatttattcaaattcgcggaccATG

    BT0788 --- BT0787 Gene: BT0788     GI: 29346198     BI number: BT0788     GOG: COG0045     Description: succinyl-CoA synthetase beta chain Gene: BT0787     GI: 29346197     BI number: BT0787     GOG: COG0074     Description: succinyl-CoA synthetase alpha chai TA A  A Cg Gc Ta T  t A  | C  |       ct Gt       t  c Gc       t  a Cg       t  a At       t  c C  |      c  t       gt Ta       c  a      a  t Cg        at       t  t G  a       ta       c  g C  t       tg       a  c G  a       ta        gc A  |       cg        cg At       a  c       ta Ta       t  g       gt Gc        at        ta At        tg        gc C  t       at        cg At        gc        gc Ta       a  g       at Gc        ta        gt Gc        gc        at                         ttttatgcttattagtcaaacatgagacaattaatatgctgtaaaacacaccattagtcttctctacgagcaaacattccgaatctttcacttgttttcattataggaatcatttattcaaattcgcggaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0045 Succinyl-CoA synthetase, beta subunit ... can be seen here [C] COG0074 Succinyl-CoA synthetase, alpha subunit ... can be seen here     ..................................................................................................................