                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAAGTTGTTTCTTCGGAGATATTCACGAAGAATTGCCTATTGCCAAAGCAACCGTT
TCACAGCACTTGAAAGAGCTGAAAGATGCAGGATTAATTCAGGGAGAAATAGAAACGC
CCAAGGTGCGATATTGTATTAATAAGGAAAATTGGGAACTTGCCCGCAAATTATTTGC
TGCATTTTTGGGAGATTGTAAATGTACAGGAACATCGTGCTGTGGATAAcagcactttttttta
agaatattgttcgtagttctacgaattacgattaagagataaactttaatatagaataaaaaATG

    BT0798 --- BT0799 --- BT0800 --- BT0801 --- BT0802 --- BT0803 Gene: BT0798     GI: 29346208     BI number: BT0798     GOG: COG0526     Description: conserved hypothetical protein Gene: BT0799     GI: 29346209     BI number: BT0799     GOG: -------     Description: hypothetical protein Gene: BT0800     GI: 29346210     BI number: BT0800     GOG: COG0785     Description: conserved hypothetical protein Gene: BT0801     GI: 29346211     BI number: BT0801     GOG: NOG15998     Description: arsenical resistance operon trans-acting repressor Gene: BT0802     GI: 29346212     BI number: BT0802     GOG: COG0003     Description: arsenical pump-driving ATPase Gene: BT0803     GI: 29346213     BI number: BT0803     GOG: COG0798     Description: integral membrane efflux pump, putative multidrug-efflux transporte AT A  G AT TA GC TA TG A  G G  A A  A G  | G  | GC TA T  T        A T  C      G  T T  |      G  A TG        TA AT        Gc CG        Ta GC        Cg T  T       Gc CG        Ta GT        Gc             ttttttttaagaatattgttcgtagttctacgaattacgattaagagataaactttaatatagaataaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here [O] COG0785 Cytochrome c biogenesis protein ... can be seen here [P] COG0003 Oxyanion-translocating ATPase ... can be seen here [P] COG0798 Arsenite efflux pump ACR3 and related permeases ... can be seen here     ..................................................................................................................