                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTATATTCGGTTTCGGGCTGGCTGGTATTCTGTTGACAAAATATTGTCCGGACCCT
GCCTTGTTTGAAACTCGTGCGGCATGGGAGGCCGCCAGTGCGAATGCGCATTATATCT
GGTATTATTTCGCTGCTATCGGGCTGATTGCCGCTATAGCTTTGCTATTATTCGCAAA
AATCACCGAATCCATCGACAAAAAGAAGAAATCTTCTCGGTAAttatcttcttttttatgtatatttg
ccgtcactttgctgtaaaagttgacggcattttgcattttaataaagaaagataaaacATG

    BT0822 Gene: BT0822     GI: 29346232     BI number: BT0822     GOG: COG1235     Description: putative metallo-beta-lactamase superfamily hydrolas             G           G  G           T  A           A  G            CG   A        GC        AT A  C       GC       A  G A  T       CG        GC GC        GC        CG TG       T  C       GC T  T      G  |       TA TG       C  |      |  T GC        TA       |  T T  |       CG       |  A T  |       AT       |  T CG       A  G      |  A CG       A  |      |  T GC        GC        GC TA        TG        AT C  T       TA        CG CG        TA        CG CG        GT        GT                         ATTATTTCGCTGCTATCGGGCTGATTGCCGCTATAGCTTTGCTATTATTCGCAAAAATCACCGAATCCATCGACAAAAAGAAGAAATCTTCTCGGTAAttatcttcttttttatgtatatttgccgtcactttgctgtaaaagttgacggcattttgcattttaataaagaaagataaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1235 Metal-dependent hydrolases of the beta-lactamase superfamily I ... can be seen here     ..................................................................................................................