                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGACAGTTGGACATCCGTTCCCGTAAGAAAGTGATCGTTTGCGAATATTGCGGACGT
ATCATGATCGACCCGGAATTGGCTGGTGTACAAATTGAGCATAAAGTAGAGGAAGCTC
CGGCTACTACTACCAAAAGAGCAATCAGAAGAAAAACTGCTGAATAAggtaccatatttgaatat
gtattcgaaagcctcgcattattgcggggctttttttatttcttctaactttactacccctttaaacaaacctaaccttgaattgttatcttttcatttc
ataaaaacctgaaccgaatATG

    BT0884 Gene: BT0884     GI: 29346294     BI number: BT0884     GOG: COG1538     Description: outer membrane efflux protein oprM precurso tg a  t ta at at gc tg ta ta a  a t  | a  | c  | c  | a  |       ta tg       t  t gc        at gc        cg A  |       gc A  |       cg T  |       tg A  |       cg At        cg Gc        gc T  |       at Cg        at Gc        at Ta        gt             tttatttcttctaactttactacccctttaaacaaacctaaccttgaattgttatcttttcatttcataaaaacctgaaccgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MU] COG1538 Outer membrane protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.30 kcal/mol Antiterminator: Size=46 nt.     Delta G= -4.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAGACAGTTGGACATCCGTTCCCGTAAGAAAGTGATCGTTTGCGAATATTGCGGACGT ATCATGATCGACCCGGAATTGGCTGGTGTACAAATTGAGCATAAAGTAGAGGAAGCTC CGGCTACTACTACCAAAAGAGCAATCAGAAGAAAAACTGCTGAATAAggtaccatatttgaatat gtattcgaaagcctcgcattattgcggggctttttttatttcttctaactttactacccctttaaacaaacctaaccttgaattgttatcttttcatttc ataaaaacctgaaccgaatATG     BT0884 Gene: BT0884     GI: 29346294     BI number: BT0884     GOG: COG1538     Description: outer membrane efflux protein oprM precurso tg a  t ta at at gc tg ta ta a  a t  | a  | c  | c  | a  | tg gc gc        ta A  |      t  t A  |       at T  |       cg A  |       gc At        cg Gc        tg T  |       cg Cg        cg Gc        gc Ta        at             ttttttatttcttctaactttactacccctttaaacaaacctaaccttgaattgttatcttttcatttcataaaaacctgaaccgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MU] COG1538 Outer membrane protein ... can be seen here     ..................................................................................................................