Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=63 nt.     Delta G= -6.16 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=31 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTG-TATACT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTGAAGTTAGTCAACAGAATATACTCTCCAAAATCTTCCAGGTTACGTTTTGTGT
AACGGGGCAGCCAATTAGCTACGATTTCTTCTTTCGTTTTCATaattatctattaaatttgtggttcc
aataatggaaaccgttatttaacttacaaaaataataaATG

    BT0887


Gene: BT0887     GI: 29346297     BI number: BT0887     GOG: NOG41868     Description: conserved hypothetical protei


            T
          C  T
          T  C
          T  T
          T  T
           AT
           GC
           CG
           AT
          |  T
          |  T
          T  T
          C  C
          G  A
           AT
           Ta
           Ta
           At
          |  t
          |  a
          |  t
          |  c
          |  t
          |  a
          |  t
  T       |  t
T  T      |  a
T  G      |  a
 GT       |  a
 CG       |  t
 AT       |  t       ta
 TA       |  t      a  a
 TA       |  g       at
 GC        At        cg
G  G       Cg        cg
A  G       Cg       |  a
 CG        Gt        ta
 CG        At        ta
T  C      C  |       gc
 TA        Gc        gc
 CG        Gc        tg
                        ttatttaacttacaaaaataataaATG


    ..................................................................................................................