                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions

CATTGGGACGGAACAACCGAGACTGAAGAAAAGATTAAAGAGGATACAAAAGCAACGA
TTCGTTGTATCCCATTCGATTCGTACGTTGAAGGTGATAAAGAACCGGGAAAATGTAT
GGTAACGGGCAAACCTTCTGCCTGCCGCGTCGTTTTTGCACGTTCTTATTAAaaatatcta
tttcaatagtaaaagagtcagatttttaaaattgagaatctgactctttttttatccatttcagttttatttcagaaatatctcttttctttgtagacag
taataaagaaaggagaagattttATG

    BT0928 --- BT0927 Gene: BT0928     GI: 29346338     BI number: BT0928     GOG: COG0745     Description: two-component system response regulator Gene: BT0927     GI: 29346337     BI number: BT0927     GOG: COG0642     Description: two-component system sensor histidine kinas           aa          a  t           at           tg           ta           tg           ta           ta           at           gc           at           cg           ta           gc           at           gc           at           at           at             ttttatccatttcagttttatttcagaaatatctcttttctttgtagacagtaataaagaaaggagaagattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................