Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -7.63 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cagtgatatatgacgtcaatttaactaatggctctccattactaatactagctttgacattagcttccattcgtttccatatatcttctagttcctgcca
ctcttcttctggaaggtcttccggttttattactggatattttacttcatcattcattgtcataattgttaatagtagccgcagtaggaactccaactgc
tgtaccaaatccatacttgttaaatcttctcataaattcattcttatccttattaattactatatttgcagtattgtttaactttaaatactcaatagat
ATG

    BT0938


Gene: BT0938     GI: 29346348     BI number: BT0938     GOG: -------     Description: hypothetical protei



  a
c  c
c  t
g  c
t  t
c  t
c  c
t  t
t  t
 gc
 at
 tg
 cg
 ta
 ta
 cg
 tg        ta
 at       t  t
|  c      t  t
t  t       ta
a  t       gc
t  c       gt
a  c       cg
 cg        cg
 cg        ta
            tattttacttcatcattcattgtcataattgttaatagtagccgcagtaggaactccaactgctgtaccaaatccatacttgttaaatcttctcataaattcattcttatccttattaattactatatttgcagtattgtttaactttaaatactcaatagatATG


    ..................................................................................................................