Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=72 nt.     Delta G= -3.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTAACAGTAATCTTAAATTAATAGCTACACAATCAGGACTTGATATTAACTTAACT
ACTTATGTAGCTCGTCACTCGTTTGCGACTGTATTGAAGAAATCAGGAGTAAATATTG
CATTAATAAGTGAAGCGTTAGGACATTCTGATTTAGCAACAACACAAATATACCTTGA
TAGTTTCGATAACGAACAGATAGATGATGCAATGAAGAACTTATTATAGtaccttcaattaatc
ccacttgtaattattgcaggtgggattttatttatatatttgccctataaggagataaagccATG

    BT0952


Gene: BT0952     GI: 29346362     BI number: BT0952     GOG: -------     Description: hypothetical protei


  G
A  T
T  T
 AT
 GC
 TG
 TA
|  T
|  A
C  A
C  C
A  G
T  A
A  A
T  C
A  A
A  G
A  A
C  T       TT
A  A      A  A
C  G      T  T
A  A       TA
 AT        CG         t
 CG        At       t  a
A  A      |  a       at
 AT       A  c       at
 CG        Gc        tg
 GC        At        gc
A  |       At        ta
 TA        Gc        tg
 TA        Ta        cg
T  T      A  a       at
A  G      A  t       cg
G  A      C  t       cg
 TA       G  a       cg
 CG        Ta        ta
 TA        At        at
 TA        Gc        at
                        ttatttatatatttgccctataaggagataaagccATG
    ..................................................................................................................