                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTACCTCCGAAGAAGATCTTATTGCTAAAGAGTTAGGCTTATTAATAGATGACATTG
TCGGAAAAATGTCGGAACAGCGGAAAATGATCTATACATTAAGCCGTCAGGAAGGGTT
GAGCAATGCTGAGATAGCAATACAGCTCAACACCACTAAAAGAAATGTCGAAAGTCAG
TTAAGCCTCGCATTAAAGGAGATACGGAAAGCTATCTCGTGCTTTTTATTATCTTTTT
TATAAaaacatccactttttcattgagctttttgtcatcagactgtatatatagtaaatacagcaaaaATG

    BT0965 Gene: BT0965     GI: 29346375     BI number: BT0965     GOG: COG3712     Description: putative anti-sigma facto            AT           C  T           G  A AT       C  A A  G       TA AT        CG        CT GC        CG       T  C A  G      G  A      A  G A  A      A  G      T  T A  A      A  A       CG A  |      T  T       GC TA        TA        AT CG        GC        AT AT       |  G       AT C  C      |  G       GT C  A      |  A       GT A  |      A  A      |  A CG       C  A      C  T AT        TG        AT AT        GC        TA C  A       AT        AT TA       A  A       GC CG        AT        AT GC        GC        GT                         TTTTATAAaaacatccactttttcattgagctttttgtcatcagactgtatatatagtaaatacagcaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PT] COG3712 Fe2+-dicitrate sensor, membrane component ... can be seen here     ..................................................................................................................