Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:126 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=26 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=49 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggatt-tatgat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggatttgcaaatataaaaaataatatgatacatacacctctataaaccatacaaaaaatggtgtcactatcctcctctcatagtgacactatactgtga
tcatagttacaccatcacggcaggatagtgtaactatattatttatgctcctattattatgcatatcgcagattgccctcatgttttttttgacaaagat
caagcgatgacgggctgtttattaagaagattagccgtatctttgtaacaaataaaaattgtatatatcATG

    BT0970


Gene: BT0970     GI: 29346380     BI number: BT0970     GOG: COG1011     Description: haloacid dehalogenase-like hydrolas


  c
c  t
t  c
c  t
c  c
 ta
 at
 ta
 cg                   g
 at                 g  c
 cg                 c  a
 ta                 a  g
 gc                  cg
 ta        tt        ta
 gc       g  a       at
 gt       a  c      c  a
 ta       t  a       cg
 at       a  c       at
a  a      c  c       cg
a  c       ta        at
a  |       at        ta
a  |       gc        ta
 at        ta        gc
 cg        gc        at
 at        tg        ta
 tg        cg        at
                        attatttatgctcctattattatgcatatcgcagattgccctcatgttttttttgacaaagatcaagcgatgacgggctgtttattaagaagattagccgtatctttgtaacaaataaaaattgtatatatcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1011 Predicted hydrolase (HAD superfamily) ... can be seen here

    ..................................................................................................................