                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGAAGAAGAACGACAACGGGTGTTGGATGAAGTGGAACGGCAACAAACTGAATTTGG
AATAGAAAAGTGAgcttggtcgaaactgaatgacagatcaatatgcttcattctttcagacctgagttatatcgaacataggctattagca
aaaatgaataagctaatagctaatctggttttgctaatagcaaattcagttttgctaatagctaatttttggcttgctgacaccttaatttcgggacttc
aaaatccagtaaagtctaaaagtccatattaggtttttcaaaaatgcataaATG

    BT0982 Gene: BT0982     GI: 29346392     BI number: BT0982     GOG: -------     Description: hypothetical protei            tg           c  g           t  t            at            at           t  t tg        cg a  a       gc        ca a  a       at       t  g a  t       ta       t  t a  a      a  a       at a  a       at        at cg        ta        at gc        cg        cg at        gc        gc ta       a  a       at ta       a  a       ta at        ta       a  a ta        at        at cg        at        ta gc        gc        cg gt        ta        gc                         taatttttggcttgctgacaccttaatttcgggacttcaaaatccagtaaagtctaaaagtccatattaggtttttcaaaaatgcataaATG     ..................................................................................................................