                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -3.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAATGCAATCCATATCAATGGAATGCCATTAGCGAATGTACACGCATATAGCTTTCC
GGCAGGAAAACATACGTTGATGTTGCCCAAAGGCTACCTTCAGGTTCTTGGATTTACG
GCTGCGGATATGAAAACTCGTAATGCCGGACTTGCCGGAGACGAAGAAACGATGGACT
GGTTGTTTTACTAAtgaacgattgctgtaagccgctatttagtttcaaggcttgaaactattagtttcatgccttgaaaccatttgttcc
aaagcttgaaacaaatagcggcaactcaacaaaaagATG

    BT0996 Gene: BT0996     GI: 29346406     BI number: BT0996     GOG: COG3250     Description: beta-galactosidas                       t                     a  t                     t  a                      cg                      at                      at                      at   a                  gc t  g        g        ta t  t      g  c      t  t t  t       at        cg a  t       at        gc t  c       cg        gc c  a       ta        at g  a       ta        at cg        ta        cg cg        gc        ta gc        at        ta at        ta        ta                         ccatttgttccaaagcttgaaacaaatagcggcaactcaacaaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3250 Beta-galactosidase/beta-glucuronidase ... can be seen here     ..................................................................................................................