                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctggtcttgttttttatattccgcaacatttcatcctttgtgtcatagtattagtcaccttcgaaacatttattgtttgtatccgacatggatggagttt
ggctagtccccaaatatgcggatatttgtgaagtgagatttcactatcaaaagtattggtcctttcggaccggccgcctgtgaaggtagctctattgttt
gttttgtttgtgtttggtgcatcttttttcaagcgagaaagaagatgcactatttatatctatctaccctgactatcggatattgaatgaaaatttgcct
ATG

    BT1004 Gene: BT1004     GI: 29346414     BI number: BT1004     GOG: COG4422     Description: conserved hypothetical protei at g  t a  t gc        tt ta       t  c gc        cg at        cg |  a       ta at        gc gc        gc ta        tg g  a       tg ta       |  c       tg ta       a  c      g  a tg        tg        ta at        gc        cg ta       a  c       cg at       a  t      g  t gt       a  g      c  a g  g       at        cg cg        cg        gc gt        ta        gt                         ctattgtttgttttgtttgtgtttggtgcatcttttttcaagcgagaaagaagatgcactatttatatctatctaccctgactatcggatattgaatgaaaatttgcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4422 Bacteriophage protein gp37 ... can be seen here     ..................................................................................................................