                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAATATAAAGGAAGCCCTTCAGTTGTAAATAAGCAGGGGAAGAAAAATTCGATTACC
GGTAAGTAAgatacgaatcttattttttatagaaagcgggcaaatatgttatttatcacatatttgcccgcttttatttagacattcatagatc
tctatcgaagtatatgcaatgacaatatgttaaaaatatagttagccaagatacaattaacttgcagatctgttttatttatatgggcttatctgtattt
tctgatattgcacattatgaaatattattcaattaagtcaagtagtatATG

    BT1006 Gene: BT1006     GI: 29346416     BI number: BT1006     GOG: COG0778     Description: putative nitroreductas cg a  a ta at gc At At        tt Ta       t  a Gt       a  t At       t  c At        ta |  t       gc |  t       ta |  t       at |  a       ta |  t       at |  a       at |  g       at |  a       cg |  a       gc |  a       gc Tg        gc Gc        cg G  g       gc Cg        at Cg        at             ttatttagacattcatagatctctatcgaagtatatgcaatgacaatatgttaaaaatatagttagccaagatacaattaacttgcagatctgttttatttatatgggcttatctgtattttctgatattgcacattatgaaatattattcaattaagtcaagtagtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here     ..................................................................................................................