                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

Acacacagtgtttcataggtatcgtttttgggttgacaaggctgtcggacttttcagggttcggcagcctattttttttacatcttacctgaataatcct
ttcaaaaagatagtgtcactatatgtctgcgataatgacactatatcagtggtatagtgacaccatttacctaggatagtgtcattatcttatttttata
aatatccccttttccgttttagtattaaatatttggaatgtagccgattacaaagtttcctttcatccgtcttttatacgatcagcgtataattaagatg
ATG

    BT1031 Gene: BT1031     GI: 29346441     BI number: BT1031     GOG: NOG39963     Description: conserved hypothetical protei ct                   c t  g                c  t gc                 a  a tg                  tg a  |        g        tg ta       a  t       ta at       c  g       at ta        tg       c  a c  a       at        cg at        ta        at cg        at        cg ta        ta        at gc        cg        gc ta        at        ta gc        cg        gt at       a  a       at ta        gc        ta at        ta        at                         cttatttttataaatatccccttttccgttttagtattaaatatttggaatgtagccgattacaaagtttcctttcatccgtcttttatacgatcagcgtataattaagatgATG     ..................................................................................................................