                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:53 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:46 nt. Size=40 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=52 nt.     Delta G=-24.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTTATA-TATACT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTATATTAATACTGTAGGTATTTATACTGAAACTGAATAAaaaatggcccaagtttattactgaatgag
cttgggctatttgctgtttatatcatgttgtgatcagttctaagttttctttgttaataaaacttagaactgatttttttcttgagtatcttatattttt
ggattgtattatctaaaaactaattaaaggaaatgctATG

    BT1035 Gene: BT1035     GI: 29346445     BI number: BT1035     GOG: -------     Description: conserved hypothetical protei ct a  g ta ta at tg ta        at tg       c  g gc       t  t at        at at        tg        gt cg        at       t  t cg        tg        ta cg        ta        ta gc       t  t      c  t gt        gc        ta ta        ta        ta at        cg        ta at        gt        ta at       t  t       gc a  g      t  c       at A  c      t  t       at At       a  a       ta Tg        ta        cg At        cg        ta At        gt        ta                         ctgatttttttcttgagtatcttatatttttggattgtattatctaaaaactaattaaaggaaatgctATG     ..................................................................................................................