                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.80 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -4.51 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -9.79 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGACTCTGCTTTGGGACTGGAGTAAGAATGGTAAGAATTTACCCAAGCCATCAAGTT
ATTCTTTTGATGATAACAAAGGGAACGGGTTTATATTCCCACCGCAAGAATAGcaacaaac
tacaataaattgtacatatagaaaaggctgcctttggaatgaggcagcctttgtttttactatacattgtaaataataacaacataaataaagagacaga
actatccactcaacaattcatatatttacacaaatatacaaattatcaaatacaaatatcaatggttatatttagtatgagATG

    BT1046 --- BT1047 --- BT1048 --- BT1049 --- BT1050 Gene: BT1046     GI: 29346456     BI number: BT1046     GOG: COG4771     Description: putative outer membrane protein, probably involved in nutrient binding Gene: BT1047     GI: 29346457     BI number: BT1047     GOG: -------     Description: hypothetical protein Gene: BT1048     GI: 29346458     BI number: BT1048     GOG: -------     Description: putative secreted endoglycosidase Gene: BT1049     GI: 29346459     BI number: BT1049     GOG: NOG43479     Description: putative patatin-like protein Gene: BT1050     GI: 29346460     BI number: BT1050     GOG: -------     Description: hypothetical protei AT T  A T  T T  T GC        aa GC       t  a GC        at C  A       at A  |       cg A  |       at G  |       ta GC       |  c GC       |  a A  G      |  t A  C      |  a A  |      |  t C  |      c  a A  |      a  g A  |      a  a T  |      a  a A  |      c  a G  |      a  a       ga T  |      a  g      g  a A  |       cg       t  t G  |       Gc        tg T  |       At        ta T  |       Tg        cg TA       A  c       cg TA       A  |       gc CG        Gc        ta TA        At        cg TA        At        gc AT       C  |       gc TA        Gt        at TG        Cg        at Gc        Cg        at                         gtttttactatacattgtaaataataacaacataaataaagagacagaactatccactcaacaattcatatatttacacaaatatacaaattatcaaatacaaatatcaatggttatatttagtatgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4771 Outer membrane receptor for ferrienterochelin and colicins ... can be seen here     ..................................................................................................................