                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.59 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTCTTCGGAGAATGGAGATGACTGGGTATCCATCGGACAATGGGATACTAAAGGAAG
AACTCAGACTATCACATTCGACGAGCGGGTTAAGACACGTTACCTGAAGTATCAGATG
ATTACTGTTCCCAGCCGCGTAGATATCACAAGGTTCTATATTTATGCATGGTAAtaagcg
tatggaataagttttccatcaattaaatatcggacaagagcagacttacaagaaaaatgtataagtttgctcttgtttttatatagagctacaatccacc
tttagcaaacataaattagataaaATG

    BT1051 Gene: BT1051     GI: 29346461     BI number: BT1051     GOG: COG3525     Description: beta-hexosaminidase precurso            ag           a  t           t  t            at            at            gc            gc            ta            at           t  c           g  a           c  a           g  t           a  t           a  a   G       t  a A  G      A  a        a A  T       At       a  a C  T       Ta       g  a A  C       Gt       a  a C  T       Gc        at TA        Tg        cg AT       A  g       at TA       C  a       ta AT        Gc       |  t GT        Ta       |  a AT       A  |       ta TA        Ta        cg GT        Tg        at CG        Ta        gt GC       A  g       at |  A      T  c       cg |  T      A  |       gc CG        Ta        at CG        Cg        gc GT        Ta        at                         tgtttttatatagagctacaatccacctttagcaaacataaattagataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3525 N-acetyl-beta-hexosaminidase ... can be seen here     ..................................................................................................................