Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -3.35 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAGAGTTGCAGGAGTGTAAAGCTAGTCTGCACCATAATACTTTGGACTGTATTTCC
GATAAGATTGAAGGAATAGAAAGAGAACTGGATGTCTTATTGGATATTCTGCAAGGGA
GGCAAGACAAAAAGACATCATAGtgctattttttatgacaatttgtctacaccgataagttatcctattatttaagcctcgtt
taagaattccgttttatgggttacccacaatcgaatggaatttttatatactgagaataacacatgatattagtaatggattttcaatattcagagtgat
aATG

    BT1109 --- BT1108 --- BT1107 --- BT1106 --- BT1105


Gene: BT1109     GI: 29346519     BI number: BT1109     GOG: COG1528     Description: ferritin A
Gene: BT1108     GI: 29346518     BI number: BT1108     GOG: COG2095     Description: conserved hypothetical protein, putative integral membrane protein
Gene: BT1107     GI: 29346517     BI number: BT1107     GOG: COG1528     Description: ferritin A
Gene: BT1106     GI: 29346516     BI number: BT1106     GOG: COG1830     Description: fructose-bisphosphate aldolase class I
Gene: BT1105     GI: 29346515     BI number: BT1105     GOG: COG0588     Description: phosphoglycerate mutase


 ca
a  c
t  c       tt
 cg       t  a
 ta       g  a
 gt        cg
 ta        ta
 ta       c  a        t
 tg       c  t      t  a
 at       g  t       gc
 at       a  c       gc
c  a      a  c       gc
 at       t  g       ta
 gc       t  t      |  c
t  c      t  t      |  a
 at       a  t      |  a
 ta       t  t      a  t
|  t       ta       t  c
t  t       at        tg
t  a       tg        ta
t  t       cg        ta
t  t       cg        gt
t  t      t  t       cg
a  a      a  t       cg
 ta       t  |       ta
 cg        ta        ta
 gc        gc        at
                        ttttatatactgagaataacacatgatattagtaatggattttcaatattcagagtgataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1528 Ferritin-like protein ... can be seen here
[U] COG2095 Multiple antibiotic transporter ... can be seen here
[P] COG1528 Ferritin-like protein ... can be seen here
[G] COG1830 DhnA-type fructose-1,6-bisphosphate aldolase and related enzymes ... can be seen here
[G] COG0588 Phosphoglycerate mutase 1 ... can be seen here

    ..................................................................................................................