Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482
Characteristics of the secondary structures
Terminator: Distance to gene:127 nt. Distance to run of Ts=0 nt. Size=38 nt. Delta G=-27.10 kcal/mol
Antiterminator: Size=29 nt. Delta G= -5.80 kcal/mol
Anti-antiterminator: Size=30 nt. Delta G=-12.10 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
GCCTTCACCCGGCTGGGCGGCAAGATACTGTACCGTTCTTCCGACATCGAGAAGCTGC
TTGACGGCTGCTACCGGGAGGCGAGAACCAGGCCGGAGGAACTTTAAaaaagttccgtacgggat
cgtgaatgaaggggcggtcggttgtcataccggtcgctccttcattttctttccaccggatgaacgactttaatttgctcgtaaaatacctatacacaga
gtgtttttttctttatgaattatgatccggtgacaacattggcataacatggcgggacatggaaacatttttccgatATG

BT1131 --- BT1132
Gene: BT1131 GI: 29346541 BI number: BT1131 GOG: ------- Description: hypothetical protein
Gene: BT1132 GI: 29346542 BI number: BT1132 GOG: ------- Description: hypothetical protei
tc
g a
ga t t
A g t ta
A a gc gc
Ta cg gc
Ta at cg
Ta tg t g
Cg | a g t
At | a gc
At | t cg
Gc | g gc
Gc | a gt
| g g a gc
A t cg gc
G a cg at
Gc tg at
Cg tg gc
Cg gc ta
ttttctttccaccggatgaacgactttaatttgctcgtaaaatacctatacacagagtgtttttttctttatgaattatgatccggtgacaacattggcataacatggcgggacatggaaacatttttccgatATG
..................................................................................................................