Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-27.10 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTTCACCCGGCTGGGCGGCAAGATACTGTACCGTTCTTCCGACATCGAGAAGCTGC
TTGACGGCTGCTACCGGGAGGCGAGAACCAGGCCGGAGGAACTTTAAaaaagttccgtacgggat
cgtgaatgaaggggcggtcggttgtcataccggtcgctccttcattttctttccaccggatgaacgactttaatttgctcgtaaaatacctatacacaga
gtgtttttttctttatgaattatgatccggtgacaacattggcataacatggcgggacatggaaacatttttccgatATG

    BT1131 --- BT1132


Gene: BT1131     GI: 29346541     BI number: BT1131     GOG: -------     Description: hypothetical protein
Gene: BT1132     GI: 29346542     BI number: BT1132     GOG: -------     Description: hypothetical protei


                     tc
                    g  a
           ga       t  t
  A       g  t       ta
A  a       gc        gc
 Ta        cg        gc
 Ta        at        cg
 Ta        tg       t  g
 Cg       |  a      g  t
 At       |  a       gc
 At       |  t       cg
 Gc       |  g       gc
 Gc       |  a       gt
|  g      g  a       gc
A  t       cg        gc
G  a       cg        at
 Gc        tg        at
 Cg        tg        gc
 Cg        gc        ta
                        ttttctttccaccggatgaacgactttaatttgctcgtaaaatacctatacacagagtgtttttttctttatgaattatgatccggtgacaacattggcataacatggcgggacatggaaacatttttccgatATG


    ..................................................................................................................