Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482
Characteristics of the secondary structures
Terminator: Distance from promoter:79 nt. Distance to gene:68 nt. Distance to run of Ts=1 nt. Size=38 nt. Delta G=-10.90 kcal/mol
Antiterminator: Distance from promoter:60 nt. Size=42 nt. Delta G=-11.20 kcal/mol
Anti-antiterminator: Distance from promoter:53 nt. Size=22 nt. Delta G= -5.90 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGAtt-tatgat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGAttctctgtggcggacggtatgatagataagccaataggatagttgagagaagaaatgttagtagttgtagattatacctgtcgtttttcatag
atagggaaatccctatttgcaagtaggaagaagtctttgcgaagggaattttctcatactacatttggggtattcaaaaaactactaaactatacctatt
atgaaaaagagtcaaatccttATG
BT1142
Gene: BT1142 GI: 29346552 BI number: BT1142 GOG: ------- Description: hypothetical protei
aa
a t
gc a
gc g a
gc a g
at at
ta gc
at gt
gt a |
at t |
tg g |
| c at
| a at
tt | a cg
t c | g gc
t a | t tg
t t | a ta
g a a g t |
cg cg a |
ta ta ta
gt ta cg
ta tg cg
cg ta cg
cg ta ta
attttctcatactacatttggggtattcaaaaaactactaaactatacctattatgaaaaagagtcaaatccttATG
..................................................................................................................