                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACCGAAACTTCGTTCAGGATTGGTTATCCATAAGTTGGATTAAgacatattctatatagaaaata
gagcggtcaatctctcacaatcaacaggacatttgtgagagattgaccgcttgtttttgtataaatgaccgcccgattccgttaaaacgaccacccgact
acctccaattgactgcttgattgcaccccatcgaccgtttgactgcatgaaatgaagcgctcgtttcaatgagaagctttaatattttcgaacagcagat
ggaatttcgtcaagaaagccgtatctttgcggcATG

    BT1150 --- BT1149 Gene: BT1150     GI: 29346560     BI number: BT1150     GOG: COG1739     Description: conserved hypothetical protein Gene: BT1149     GI: 29346559     BI number: BT1149     GOG: -------     Description: Type II restriction enzyme HpaI cg c  t at gt cg ta |  c at cg c  c                 tc c  a                t  a c  |                 ta at                  gt cg         c        cg g  a      g  g       ta ta       a  c       cg ta        at       |  a at        gc       g  a g  g       tg        cg ta        at        gc ta        at        at cg        at        at gc        gc        gt tg        ta        ta                         atattttcgaacagcagatggaatttcgtcaagaaagccgtatctttgcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1739 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................