                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -6.67 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-10.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCCGTCTCGTTGTGGAAACGAAATACGTGACCCCGAAAGCACTCGAAGTCTTGAAA
CAAAAACCGATCCGCCTGCCGGCATGGGATCCAATGTTTGCCGGCGAAGAATAAccaacc
gacaaacacgctgcatagacttgtacgctgcaaggtcttccggcctactttattaaagaacgtgtgcgaacacaaaaggaattacggatatttttccgta
attcctttcttttttcctcccgaatcacattattatttattacttttgcggcaaattttatgaaaccattattttatatagcATG

    BT1160 Gene: BT1160     GI: 29346570     BI number: BT1160     GOG: COG1726     Description: Na+-translocating NADH-quinone reductase subuni            cg           g  a            ta tc        gc t  c       ta cg        gc tg       c  a gc       a  a gc       a  a at       g  | |  a      a  | |  c      a  | |  t      a  | |  t      t  | |  t      t  | |  a      a  | |  t      t  |       tt |  t      t  |      a  t |  a      t  |      t  t |  a      c  |       at |  a      a  |       gc a  g       ta        gc c  a       cg        cg g  a       cg        at t  c      |  a       ta cg       |  a       ta gt       |  t       at cg       |  t       at at       g  a       gc tg        gc        gc gc        cg        at tg        cg        at ta        ta        at                         cttttttcctcccgaatcacattattatttattacttttgcggcaaattttatgaaaccattattttatatagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1726 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrA ... can be seen here     ..................................................................................................................