                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctgtaagttcattttttggttgcgagcaatcgactttatagccactggaaagcaaattccgggaaggcgttcgcaacaggaacaagtcagaagacctac
catgcaaactcgtttcactgctttcgaggaaaaagcgatgagtctaatgaaccggacaatccgtccatcatttcattcaccattctgattcagagaaagt
gtgtactaattaataaactctgccaagtttattatgatgtccggtcgaagtgagttcgcccggacatctttttacattatgaacagactgaaagaaaaca
ATG

    BT1489 --- BT1490 --- BT1491 Gene: BT1489     GI: 29346899     BI number: BT1489     GOG: COG4206     Description: vitamin B12 receptor, outer membrane Gene: BT1490     GI: 29346900     BI number: BT1490     GOG: COG3391     Description: conserved hypothetical protein, putative surface protein Gene: BT1491     GI: 29346901     BI number: BT1491     GOG: NOG43437     Description: hypothetical protei            gc ta       t  c        g c  a      c  a      t  a a  t       ta       g  g t  t       cg        at g  a       at        at ta        at        gc gt        at        cg ta        ta       t  c g  a       at        gc a  a       at        gc a  |       ta        cg a  |      t  t       cg gc       a  g       ta at       a  a       gc gc       t  t       ta at        cg        at cg        at        gc                         tttttacattatgaacagactgaaagaaaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4206 Outer membrane cobalamin receptor protein ... can be seen here [S] COG3391 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................