                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions

AAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAgtccacaaaaacggacatcgaa
cttttgccactggtgtaataccgggaaggcacgatgaccgggacgagtcagaagacctgccatgaccggaatgagatttacacctgcgggatatacgggt
cgtaatcaaataaggaatagctcatcggccattcaatatttgaagacagacatattcccgttcgtgtaagtccgcacgaacgggaattttttgtgtttgt
taataatatgttttacattaaaatgagtgacctATG

    BT1957 Gene: BT1957     GI: 29347367     BI number: BT1957     GOG: -------     Description: hypothetical protei           gt          a  c          a  c           tg           gc           ta           gc           cg           ta           ta           gc           cg           cg           cg           ta             attttttgtgtttgttaataatatgttttacattaaaatgagtgacctATG                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482 This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-22.50 kcal/mol Antiterminator: Size=77 nt.     Delta G=-18.60 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-14.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAgtccacaaaaacggacatcgaa cttttgccactggtgtaataccgggaaggcacgatgaccgggacgagtcagaagacctgccatgaccggaatgagatttacacctgcgggatatacgggt cgtaatcaaataaggaatagctcatcggccattcaatatttgaagacagacatattcccgttcgtgtaagtccgcacgaacgggaattttttgtgtttgt taataatatgttttacattaaaatgagtgacctATG     BT1957 Gene: BT1957     GI: 29347367     BI number: BT1957     GOG: -------     Description: hypothetical protei            at           t  t            ac            cc            ac           g  g            at            ct            ac            gg           a  t           a  g            gt            ta            ta            tg            at at        t c  c       a tg       a cg       c gc        t a  c       t ta       | at        a at        c gc        c g  a      |         gt a  a      |        a  c at       |        a  c ta       |         tg at       |         gc at       |         ta at       |         gc cg       |         cg ta       |         ta a  a      |         ta a  g       g        gc ta        g        cg gc        c        cg |  a       t        cg cg        a        ta ta        c        ta gc        t        at                         tttttgtgtttgttaataatatgttttacattaaaatgagtgacctATG                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................