                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:146 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -6.90 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=61 nt.     Delta G=-36.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGACC-TATAAt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGACCAAAGAAAAAGAAGTTTTATAAtacacgacaaatgaggagaagaggagatttcacggcattgcaaaaatgccgct
gaaatctcctcttcgttttttcaacggaggacttgtttttacatgattccttgttttccttctgctaaattcgtaattttaccgccgattcacgcaatag
gggtgccctaacatgacaggctgagaacatacccatagaatctgatccgggtaatgccggcgtagagaacgaataaataagcaaatATG

    BT2396 --- BT2397 Gene: BT2396     GI: 29347806     BI number: BT2396     GOG: COG3201     Description: putative membrane transporter involved in nicotinamide mononucleotide transport Gene: BT2397     GI: 29347807     BI number: BT2397     GOG: COG1564     Description: conserved hypothetical protei   a c  a g  a ta ta at cg gc gc cg |  c at cg ta ta ta at gc at         t gc       t  t gc       t  c at        ta gc        ta at        gc at        cg gc       t  | |  g      t  | at        cg gt        ta gt        cg at        cg gt        ta             cttgtttttacatgattccttgttttccttctgctaaattcgtaattttaccgccgattcacgcaataggggtgccctaacatgacaggctgagaacatacccatagaatctgatccgggtaatgccggcgtagagaacgaataaataagcaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG3201 Nicotinamide mononucleotide transporter ... can be seen here [H] COG1564 Thiamine pyrophosphokinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................