                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:175 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgctt-gaaaat. It has a score value of 62.25 and is shown in blue

tcgctttttgttcgcatctaacagaaaattattacttttgccccagaattagaaaccaaagcagaaacaaagattcgtatgaaatcattttcttatgcat
attacttctttttttacttttactttagccagaaagtagagcgggagtttgtatgtatcaagtgacatgatgcttaaggactgagatgaagaaattaatc
atataaatcccgcttccatatggacgcgggatttttttatataaccctattagaacaATG

    BT3936 --- BT3935 Gene: BT3936     GI: 29349344     BI number: BT3936     GOG: COG0077     Description: prephenate dehydratase Gene: BT3935     GI: 29349343     BI number: BT3935     GOG: COG0436     Description: aminotransferas           ta          a  t           cg           cg           ta          t  c           cg           gc           cg           cg           cg           ta           at           at           at             ttttatataaccctattagaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here     ..................................................................................................................