Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATC-TATGAT. It has a score value of 61.58 and is shown in blue

TTTATCTTTGCTGGTCTCACAGCTTATGATACGCAAAACATTAAATTGATGTATTATG
AAGGAGATGCAAATGACACCCAAGGACGTAAGATTATTATGGGTGCGTTAAATCTTTA
CCTTGATTTCATTAATATGTTTGTCTTCTTGCTGCAATTTCTTGGTTCGAACCGTGAT
TGAttgtagctatcatttctcaattaaaaaaccttgtttcttaaaggaaacaaggttttttagtttttgatgcaagcctatacccttcactaccTTG


    BH00070


Gene: BH00070     GI: 49474838     BI number: BH00070     GOG: COG3568     Description: hypothetical protei


          aa
         t  a
          tg
          cg
          ta
          ta
          ta
          gc
          ta
          ta
          cg
          cg
          at
          at
          at
          at
          at
          at
          ta
          tg
            tttttgatgcaagcctatacccttcactaccTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3568 Metal-dependent hydrolase ... can be seen here

    ..................................................................................................................