                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGAATGCTGAACAGCTTTGGGAAACAACGCTTAATCCTGATGCGCGCGCTCTTTTA
CAAGTTAAAATCAATGATGCAACTGATGCAGATTCGCTCTTTTCCCGTTTGATGGGTG
ATGAAGTTGAACCACGGCGGGCTTTTATTCAAGATAATGCCTTAAGTGTTGCTAATCT
TGATATCTAAaggtactctttttctagctgtataaacgtcgtggttttatagagggcttttgcatatttgaacattccttctacacttcattt
acgacaaaagaaaaaataaggaaggtcacgcatATG

    ubiE --- aarF Gene: ubiE     GI: 49474866     BI number: BH00400     GOG: COG2226     Description: Ubiquinone/menaquinone biosynthesis Gene: aarF     GI: 49474865     BI number: BH00390     GOG: COG0661     Description: Ubiquinone biosynthesis protein aar   A A  T CG TA AT A  G A  C                  A A  |                A  G TA                 G  T TA                 T  T GC                 A  G AT                 G  A A  G       GT        TA C  A      C  T       GC A  T      C  T       GC T  G       CG       G  A T  C       TA       T  C T  |      T  T      A  | TA       T  |      G  | CG       T  |      T  | TA        CG        TG |  T       TG        TG C  T       CG        GC GC        GT        CG CG        CG        CG GC        TA        CG                         CTTTTATTCAAGATAATGCCTTAAGTGTTGCTAATCTTGATATCTAAaggtactctttttctagctgtataaacgtcgtggttttatagagggcttttgcatatttgaacattccttctacacttcatttacgacaaaagaaaaaataaggaaggtcacgcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2226 Methylase involved in ubiquinone/menaquinone biosynthesis ... can be seen here [R] COG0661 Predicted unusual protein kinase ... can be seen here     ..................................................................................................................