                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:172 nt.    Distance to gene:15 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=75 nt.     Delta G=-18.00 kcal/mol
Anti-antiterminator:    Distance from promoter:77 nt.    Size=60 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaagt-tattat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaagttctatgggcatttttgatattatacgaacatatggatggataagaccaacagatatgcaagagttaagagtatttgggtaccctttcaatcgtt
tttattgagtttagtaaacaaaatcctcatttgttaggatatgaggagttgtgttttgagaagctcttttcgtttatatttttttgaaaggttttcaaaa
gagcacaattggtctttgcgttttgtgctattctttgctaaatcgcccgtATG

    lepA Gene: lepA     GI: 49474893     BI number: BH00710     GOG: COG0481     Description: GTP-binding protein lep            at           t  t           a  t           t  t           t  t           t  t            gt            cg            ta ta        ta t  g       ta g  g       tg t  a       cg t  t      t  t ta       c  | at        gt cg        at ta        at cg        gc cg       |  a ta       a  a |  g      g  a a  t       ta a  t       tg a  g       ta at        tg cg        gc        tt at        ta       c  t at        gc        tg at        ta        gc |  t       ta       g  g t  g       gt       t  t g  a      |  t      t  t a  g      |  g       at ta       |  g       at ta        at        cg tg        gc        at gc        gt        cg at        at        gc gc        gt        at                         attctttgctaaatcgcccgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0481 Membrane GTPase LepA ... can be seen here     ..................................................................................................................