                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGCAGCTGTCCGTGCAGAAGGTTTAACTTATGGACGCTTTATTGATGGTTTATCAA
AGGCTGGTATTGAGATTGATCGTAAGGTTCTTTCAGACATAGCAATTCATGAGTCAGC
GGCATTTTCTGCTTTAGTAGCTTCTGCAAAGAAAGCTTTGGAATATTTGAAAGATACA
ACGCCTAATGCTTTTGAAGGCGCTGTCAAGTAAgccagtcgcgttctcttaaagcattcatttattcgggatcccg
tactggttaggctagtgcgggttttttttattcaaaaaataggcaaagatATG

    pheS --- pheT Gene: pheS     GI: 49474906     BI number: BH00840     GOG: COG0016     Description: Phenylalanyl-tRNA synthetase alpha chain Gene: pheT     GI: 49474907     BI number: BH00850     GOG: COG0072,COG0073     Description: Phenylalanyl-tRNA synthetase beta chai GT A  A A  A        t C  g      a  t T  c      c  c Gc       g  a Ta        at Cg        at |  t       at Gc        ta         a Cg       |  t      t  g Gc       |  t      t  g G  g      t  c       gc At        cg        gt At        tg        ta Gc        cg        cg |  t       ta        at |  c      |  t       tg |  t      |  c       gc T  t      t  c       cg Ta        gc        cg Ta        cg        cg Ta        gt       t  t Cg       c  |       at Gc        ta        gt Ta        gc        gt At        at        gt                         tttattcaaaaaataggcaaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here     ..................................................................................................................