                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.66 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCTGTTGAatctttttctcatctataaatattcaccaaataggagcactccgagaagtgctcccttattttcagacattcaagagctgt
ggagttttttgaaaggaccttcatactaaagagattctctttaaatattagtctttttcaaggcgaaaaagactattttaaaatcacttaaaaagttgtc
cttttgtaaagatccttcattgcaaaggtaaaaaataactgttattgctaaatgataatgcaaatcattagcaataaagagagagcatatgaaggaaaga
gaggatcaATG

    yfeA --- yfeB --- yfeC --- yfeD Gene: yfeA     GI: 49474908     BI number: BH00860     GOG: COG0803     Description: Iron transport protein yfeA Gene: yfeB     GI: 49474909     BI number: BH00870     GOG: COG1121     Description: Iron transport protein yfeB Gene: yfeC     GI: 49474910     BI number: BH00880     GOG: COG1108     Description: Iron transport system membrane protein yfeC Gene: yfeD     GI: 49474911     BI number: BH00890     GOG: -------     Description: Iron transport system membrane protein yfe ga t  a        t ta       a  t tg        gc tg        at ta        gc t  c       at gc        at at        at gt        ta gc       c  a ta       a  a        g gt       t  t      a  g ta       a  a      a  c c  |      c  t       cg gc       t  t       ta at       t  a       ta g  a      c  |       ta a  a       cg        ta a  a       at        ta cg        gc        cg ta        gt        ta tg        at        gc                         tattttaaaatcacttaaaaagttgtccttttgtaaagatccttcattgcaaaggtaaaaaataactgttattgctaaatgataatgcaaatcattagcaataaagagagagcatatgaaggaaagagaggatcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0803 ABC-type metal ion transport system, periplasmic component/surface adhesin ... can be seen here [P] COG1121 ABC-type Mn/Zn transport systems, ATPase component ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here     ..................................................................................................................