                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-10.57 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTGCCGAAGAAAAAGAAGCTGTTGCACAATATGGTTCTACAGATTCAGGTGCTTCC
CTTGGCGATATTCTCGGTGCGGCTTTGAAAAAACAAGAACAAGATTAAtatgattgaatagatt
acattaaggtcgcctttttctctagcggcctttttttatttttcaatgcaaacacctgattgcattttcaattgtctagttgaaaaattataaatatttc
atacaaatcttattatgggaatagaaataccgacatcctcttgaataaaacggcataattaaatcacaataaaatattATG

    BH00920 Gene: BH00920     GI: 49474914     BI number: BH00920     GOG: COG3459     Description: Cyclic beta 1-2 glucan synthetas             t           A  a           A  t            Tg            Ta            At            Gt           A  g           A  a           C  a           A  t           A  a           G  g           A  a           A  t           C  t AT       A  a G  A      A  c C  T      A  a GT       A  | GC       A  |        t T  T       At       t  c T  C       Gt       t  t CG        Ta       t  c CG        Ta       t  t C  T       Tg       c  a T  |       Cg        cg T  |       Gt        gc CG        Gc        cg GC        Cg        tg TG        Gc        gc G  G      T  |       gc GC        Gc        at AT        Gt        at                         tttttatttttcaatgcaaacacctgattgcattttcaattgtctagttgaaaaattataaatatttcatacaaatcttattatgggaatagaaataccgacatcctcttgaataaaacggcataattaaatcacaataaaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3459 Cellobiose phosphorylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.10 kcal/mol Antiterminator: Size=64 nt.     Delta G=-10.57 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AATTGCCGAAGAAAAAGAAGCTGTTGCACAATATGGTTCTACAGATTCAGGTGCTTCC CTTGGCGATATTCTCGGTGCGGCTTTGAAAAAACAAGAACAAGATTAAtatgattgaatagatt acattaaggtcgcctttttctctagcggcctttttttatttttcaatgcaaacacctgattgcattttcaattgtctagttgaaaaattataaatatttc atacaaatcttattatgggaatagaaataccgacatcctcttgaataaaacggcataattaaatcacaataaaatattATG     BH00920 Gene: BH00920     GI: 49474914     BI number: BH00920     GOG: COG3459     Description: Cyclic beta 1-2 glucan synthetas   a t  c t  a at gt aa ta a  g a  g g  t t  c t  g a  c g  c t  t a  t t  t A A T  | T  | A         t G       t  c A       t  t A       t  c C       t  t A       c  a A        cg G        gc A        cg A        tg C  |       gc A        gc A        at             ttttttatttttcaatgcaaacacctgattgcattttcaattgtctagttgaaaaattataaatatttcatacaaatcttattatgggaatagaaataccgacatcctcttgaataaaacggcataattaaatcacaataaaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3459 Cellobiose phosphorylase ... can be seen here     ..................................................................................................................