Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:72 nt. Distance to gene:141 nt. Distance to run of Ts=0 nt. Size=37 nt. Delta G=-10.90 kcal/mol
Antiterminator: Distance from promoter:11 nt. Size=67 nt. Delta G= -8.20 kcal/mol
Anti-antiterminator: Size=47 nt. Delta G= -7.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGGAC-TATTTT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGGACTATCTGCATCACGGTGGTATTTTGCAATATGTTTTGCGTAATCTGGCAGTTT
AAatcgcatttgtttgtttaggagtgtcttcaaaatctttagttgggcgtcaaggagtttgttttcattttttgtgtccatttttgagaattcgattga
cgttggctgtagaattgcgttataaactggccagttatcggcaactttataatttaatttagatgtgtttatgttggtagagatatccgttgtgcattcc
taccgatgagtaagagagaggtatttATG
rpsT
Gene: rpsT GI: 49474935 BI number: BH01170 GOG: ------- Description: 30S ribosomal protein s2
gt
t t
t t
t a
g g
tg
ta
tg
T at
T T cg
T G gt
GC c c
TG t t
AT a t
TA A c
| A A a tt
| T Ta g t
| C Ta t t
A T Ta t c
A G Gt ta
CG A c gt
GC C t at
TA Gt gt
TG Gt gt
T T Ta at
T T Cg at
AT T | cg
TA At t |
G A At gt
G | Tg cg
Ta G g gt
Gt Cg gc
Gc Gc gc
Cg Tg ta
tttttgagaattcgattgacgttggctgtagaattgcgttataaactggccagttatcggcaactttataatttaatttagatgtgtttatgttggtagagatatccgttgtgcattcctaccgatgagtaagagagaggtatttATG
..................................................................................................................