Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=40 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-aagaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgactggtgtgtttttcattttagaagaatggatcatatcatgaatgcaagtaagtcttattggtcatctttattagtggggttgtgatgagattatcc
tagggggcgggatgataatcttatttggggtagggcgttttgcctttgctaagttgattttagctgtttggcgagacaaagtttttgtttttatcgggat
gaaagATG

    dnaA


Gene: dnaA     GI: 49474936     BI number: BH01180     GOG: COG0593     Description: Chromosomal replication initiator protein


 gt
a  a
a  a
 cg
 gt
t  c
a  |
 at        ta
 gt       t  g
 ta        at
 at        tg         g
c  |       tg       g  g
t  |       tg       g  g
a  |       cg       a  c
t  |      t  t       tg
 at        at        cg
 cg        cg        cg
 tg       t  t       ta
 at       g  |       at
 gc       g  |       tg
g  a       tg        ta
t  |       ta        at
a  |       at       g  a
 at        tg       a  |
 gc        ta       g  |
 at        cg        ta
 at        ta        at
 gt        gt        gc
                        ttatttggggtagggcgttttgcctttgctaagttgattttagctgtttggcgagacaaagtttttgtttttatcgggatgaaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0593 ATPase involved in DNA replication initiation ... can be seen here

    ..................................................................................................................