Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -4.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatgtctggtttatcgcattaccccattgctgaaaataatgtatcttgactacaacgatcagatacaaggcttttacataagctcgtaattgtgaactca
atcatccattatcaaaagcaccttagagtaaaaagatgagaattttaaaaagcgctatagacaaataccttctttatgtgatataggcctatacgttgtg
cgtaaggtatacgtgtgatacgtttccttttagatctatttttaaaaggaactggattctttcctattatttgtgacactaaaataaagcaggataaata
GTG

    rpsU


Gene: rpsU     GI: 49474950     BI number: BH01320     GOG: -------     Description: 30S ribosomal protein s2


            g
          t  t
          t  g
           gc
           cg
           at
           ta
  t       a  |
c  t       ta
c  c       cg
a  t       cg        ta
t  t       gt       c  t
a  t      |  a      t  t
a  a      |  t       at
 at       |  a       gt
 cg       |  c       at
 at       g  g       ta
|  g       at        ta
g  a       tg        ta
 at        at        ta
 ta        tg        cg
 at       a  a       cg
 ta        gt        ta
 cg        ta        ta
g  |       gc       t  c
 cg        tg        gt
 gc        at        cg
                        gattctttcctattatttgtgacactaaaataaagcaggataaataGTG


    ..................................................................................................................