Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -6.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

catgaagctatttttgttatgaaatgaatcacgattttttggatggagattatgtaatattcttaaagcttgtgttttgctttattttttagcttgaatc
cctctagctaaaagggttggggacttttctagattcaatgtttttgcagagactttaggatgatgccgtagtgaatatcggtatcacggggggatagatt
ttatctttatttgttggtttttggggtgcgcgaacaggggttttgccatgagagtttttgcgccttgtgatgctattggactctgttggaggaggttctt
ATG

    badA1


Gene: badA1     GI: 49474963     BI number: BH01490     GOG: -------     Description: Surface protein/Bartonella adhesi


  g
t  t
g  t
t  t
t  t
 cg
 gc
 at
 at
 at
 ta
t  t
c  t
t  t
t  t
a  t
t  t        c
a  a      t  c
a  |      a  c
 tg        at         a
 gc        gc       a  a
t  t      t  t      a  g
 at        ta        tg
 tg        cg        cg
 ta        gc        gt
a  a       at        at
g  |       ta        tg
 at        ta        cg
 gc        ta        tg
 gc        ta        cg
                        acttttctagattcaatgtttttgcagagactttaggatgatgccgtagtgaatatcggtatcacggggggatagattttatctttatttgttggtttttggggtgcgcgaacaggggttttgccatgagagtttttgcgccttgtgatgctattggactctgttggaggaggttcttATG
    ..................................................................................................................