                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:135 nt.    Distance to gene:21 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:74 nt. Size=76 nt.     Delta G= -9.31 kcal/mol
Anti-antiterminator:    Distance from promoter:55 nt.    Size=57 nt.     Delta G= -4.07 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-tataaa. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaaatttttcataaaacagtataaaaatcaatctttcaaaacaaaagcctttatttaaaaagagtttcaaaatgctttgaaggactagtattttga
ccttctttcctatataaatgttacgataaataagaagtctttgactcttcttgttttctcacagacccttgctgaacgacatctcggctatgggtgactt
ttgtttattcattttttgaaaggataagacgATG

    rpsO Gene: rpsO     GI: 49475023     BI number: BH02110     GOG: COG0184     Description: 30S ribosomal protein s1             t           t  g           t  a           c  c           t  t            gc            at            at            gc ct        at c  a       at t  t       tg t  a       at t  t       at c  a       at t  a      t  | t  a       at c  t       gc cg       c  t at       a  c gt       t  | ta        ta |  c       gc |  g       ta |  a      |  g       ac |  t      a  a      g  a ta       a  c      c  t ta       a  c      a  c ta       t  c       at at       a  t       gc ta       t  t       tg |  a      a  g       cg g  g      t  c       gc a  a      c  t      |  t ta        cg       t  a cg        ta       t  t at        ta        cg gc       t  c       cg gt        cg        cg at        ta        at                         gacttttgtttattcattttttgaaaggataagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0184 Ribosomal protein S15P/S13E ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:123 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=45 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ctatcgctttttttttacaatatacattctgttaagcaggaatctttgtctcaaaaggatgcataattctttaaaaatttttcataaaacagtataaaaa tcaatctttcaaaacaaaagcctttatttaaaaagagtttcaaaatgctttgaaggactagtattttgaccttctttcctatataaatgttacgataaat aagaagtctttgactcttcttgttttctcacagacccttgctgaacgacatctcggctatgggtgacttttgtttattcattttttgaaaggataagacg ATG     rpsO Gene: rpsO     GI: 49475023     BI number: BH02110     GOG: COG0184     Description: 30S ribosomal protein s1 tt t  a a  a ta ta ta cg |  a cg gt at        ag at       a  g |  c      g  a |  a      t  c |  a      t  t |  a       ta a  a       cg at        gt cg        ta a  c       at at        at at        at at        at cg        cg ta        ta             ccttctttcctatataaatgttacgataaataagaagtctttgactcttcttgttttctcacagacccttgctgaacgacatctcggctatgggtgacttttgtttattcattttttgaaaggataagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0184 Ribosomal protein S15P/S13E ... can be seen here     ..................................................................................................................