                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTATGTAAACTGGACCCTTTACCATTGTTCAAACCATCACAGTTTTGAATGGGAAGCA
AAAAATCCTAAGGATTGGAAAACACCTTATACGCTATGGTCAGGCACTCGTTATGAAG
CAAAAGCTTTACGCGAAGGACGAGCACCTACTTATCTTACTTTTATCAAGAAATAGat
gatgaaacgctcttcttataaaaaaacttgaaaaatttttaatttaagagtatcaatggttaaattcttggtcttatgatgaagagtgggccgtctggac
ccgctcttttttatgtcataaaactaATG

    BH02180 Gene: BH02180     GI: 49475030     BI number: BH02180     GOG: COG0779     Description: hypothetical protei aa g  a ta ta c  | a  | a  | at at at at at ta a  a t  t       ta t  t      t  t c  t       cg ta        ta ta        gt cg       g  g ta        ta        tc cg        ta       g  t gt        cg        cg c  a       ta        cg a  t       tg       |  a a  c       at        gc a  a      a  g       gc g  |      a  g       gc ta       t  |       tg at        tg        gc g  g       gc        at tg        gc        gc at        tg        at Gt        at        at                         ttttatgtcataaaactaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................