                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-15.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTATCTGCAATCACCACGTGAAGCGTTTCCAGGGACGATTATGTTTTTTCGTGGGA
TCAAAAATGACCAAGATCGTGCCGATCTTTTGCTTTATTTACGGGGTTTATCCGATGA
CCCTGTTCCCTTACCGAACGATAAAAAAGAAGACAAGCCAGGCTGAactatgccagaagcgcctat
tttatgaagaggtgcaattgttttttgtttgtaatttgagttttatagatttatcaaaaaaggtgtatcattattttatattgactcgatcgactgtatc
ggaaagtgaaaataaaaaATG

    BH02380 --- BH02390 --- BH02400 Gene: BH02380     GI: 49475050     BI number: BH02380     GOG: COG4174     Description: Peptide ABC transporter, permease protein Gene: BH02390     GI: 49475051     BI number: BH02390     GOG: COG4239     Description: Peptide ABC transporter, permease protein Gene: BH02400     GI: 49475052     BI number: BH02400     GOG: COG0444,COG1123,COG4172     Description: ABC transporter, ATP-binding protei CC T  G A  A T  T TG TA GC GC GC GT CG AT |  T |  C |  C |  C |  T |  T       ac |  A      A  t |  C      G  a |  C      T  t |  G       Cg |  A       Gc |  A       Gc T  C      |  a TG       |  g TA       A  a AT       C  a        a TA        Cg       t  t TA        Gc        tg TA       A  g       ta C  A      A  c       ta G  A      C  c      a  g TA       A  t       ta TG       G  a       cg TA        At        cg TA        At        gt CG        Gt        cg TA        At        gc                         aattgttttttgtttgtaatttgagttttatagatttatcaaaaaaggtgtatcattattttatattgactcgatcgactgtatcggaaagtgaaaataaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4174 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG4239 ABC-type uncharacterized transport system, permease component ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [R] COG1123 ATPase components of various ABC-type transport systems, contain duplicated ATPase ... can be seen here [R] COG4172 ABC-type uncharacterized transport system, duplicated ATPase component ... can be seen here     ..................................................................................................................