                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAACAATCTCTAGTGGCAAATATCCAGTTTCTCGTCCACTCTTCTTCTATGTTAAG
AAAGCGCATTTAGGTATTATTCCAGGTTTGCGGGAATATGTAGACTTTTTTCTTTCTG
ATCAAATGATTGGTCCCAATGGTCCATTGGCTGAATATGGTTTGGTCGTTGCTTCTGA
AAAAGAGCGCCAAGCGCAGCGTTCTGCTTTTTCTGCTGGTAGAGTGATGAGTTTGAAA
TAAttttctggatttaccggtgtaggagtttttttgtgctgctttatttatgaaaattgaaagacaatATG

    BH02440 --- pstA --- pstB --- phoU Gene: BH02440     GI: 49475056     BI number: BH02440     GOG: COG0573,COG4590     Description: ABC transporter permease protein Gene: pstA     GI: 49475057     BI number: BH02450     GOG: COG0581,COG4985     Description: Phosphate transport system permease protein Gene: pstB     GI: 49475058     BI number: BH02460     GOG: COG1117     Description: Phosphate transport system ATP-binding protein Gene: phoU     GI: 49475059     BI number: BH02470     GOG: COG0704     Description: Phosphate transport system protein pho   T G  C GC TA AT AT CG CG |  C |  T CG        GA TA       T  A G  A      C  A G  T       TA T  |       TA TA        CG AT       G  |       GC G  G       TA       A  G TG        TG       A  C AT        GC       C  A AT        CG        CG AT       T  |       GC CG        GC        CG TG        GC        GT AT        TA        AT GC        TA        GC TG        TG        AT                         GCTTTTTCTGCTGGTAGAGTGATGAGTTTGAAATAAttttctggatttaccggtgtaggagtttttttgtgctgctttatttatgaaaattgaaagacaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0573 ABC-type phosphate transport system, permease component ... can be seen here [R] COG4590 ABC-type uncharacterized transport system, permease component ... can be seen here [P] COG0581 ABC-type phosphate transport system, permease component ... can be seen here [P] COG4985 ABC-type phosphate transport system, auxiliary component ... can be seen here [P] COG1117 ABC-type phosphate transport system, ATPase component ... can be seen here [P] COG0704 Phosphate uptake regulator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:189 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.70 kcal/mol Antiterminator: Size=28 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAAACAATCTCTAGTGGCAAATATCCAGTTTCTCGTCCACTCTTCTTCTATGTTAAG AAAGCGCATTTAGGTATTATTCCAGGTTTGCGGGAATATGTAGACTTTTTTCTTTCTG ATCAAATGATTGGTCCCAATGGTCCATTGGCTGAATATGGTTTGGTCGTTGCTTCTGA AAAAGAGCGCCAAGCGCAGCGTTCTGCTTTTTCTGCTGGTAGAGTGATGAGTTTGAAA TAAttttctggatttaccggtgtaggagtttttttgtgctgctttatttatgaaaattgaaagacaatATG     BH02440 --- pstA --- pstB --- phoU Gene: BH02440     GI: 49475056     BI number: BH02440     GOG: COG0573,COG4590     Description: ABC transporter permease protein Gene: pstA     GI: 49475057     BI number: BH02450     GOG: COG0581,COG4985     Description: Phosphate transport system permease protein Gene: pstB     GI: 49475058     BI number: BH02460     GOG: COG1117     Description: Phosphate transport system ATP-binding protein Gene: phoU     GI: 49475059     BI number: BH02470     GOG: COG0704     Description: Phosphate transport system protein pho   T T  A A  T T  T       AA GC       G  T GC       G  A |  A       GT A  G       CG T  G       GT T  T       TA T  T       TG AT        TA CG        GC GC        GT CG        AT             TTTTCTTTCTGATCAAATGATTGGTCCCAATGGTCCATTGGCTGAATATGGTTTGGTCGTTGCTTCTGAAAAAGAGCGCCAAGCGCAGCGTTCTGCTTTTTCTGCTGGTAGAGTGATGAGTTTGAAATAAttttctggatttaccggtgtaggagtttttttgtgctgctttatttatgaaaattgaaagacaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0573 ABC-type phosphate transport system, permease component ... can be seen here [R] COG4590 ABC-type uncharacterized transport system, permease component ... can be seen here [P] COG0581 ABC-type phosphate transport system, permease component ... can be seen here [P] COG4985 ABC-type phosphate transport system, auxiliary component ... can be seen here [P] COG1117 ABC-type phosphate transport system, ATPase component ... can be seen here [P] COG0704 Phosphate uptake regulator ... can be seen here     ..................................................................................................................