                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACTATAAAACCAATGATTTCCGTGTTGGTGTCGCTTACAAATTCTAAtttgttttgagattaa
attttgaagaggctctgccagaggtggagcctttatttttaaagaggatcattttagggtttcctttcttgatagtttcatgataaagcccttaaaatgt
gatgatatatcttcttgatcgctgcctaatacgaatgattggctcggctttcctcatagatcaaaaaaccagagttgcagggttcagggaagttatgcaa
aaataaaatcgtaaaagtagacaggaatatttcacaATG

    ileS Gene: ileS     GI: 49475069     BI number: BH02580     GOG: COG0060     Description: Isoleucyl-tRNA synthetas tt t  t g  g ta tg ta At At Ta C  a T  a T  t At At At Cg A  | Ta Ta         g Cg       a  a G  a       cg Cg        cg Tg       g  t Gc       t  g |  t       cg |  c       ta |  t       cg Tg        gc Gc        gc Gc        at Ta        gt Tg        at             atttttaaagaggatcattttagggtttcctttcttgatagtttcatgataaagcccttaaaatgtgatgatatatcttcttgatcgctgcctaatacgaatgattggctcggctttcctcatagatcaaaaaaccagagttgcagggttcagggaagttatgcaaaaataaaatcgtaaaagtagacaggaatatttcacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here     ..................................................................................................................