                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:118 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=62 nt.     Delta G=-10.41 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=37 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtgt-tattat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtgtaaaaaatttacctttttgccttattatactttggtacatggcctgttctacaggagaaaattcttgaaaaaatacgcgaaaaattgcaattttt
cttccctttagagttttaattcttctcaagggagagatttttttatttccaaaaatatgaagggtgttttgtgagataaaaaattgggtgcaatgaacag
agttgataaattttttaacaaaagaagcttatagagacttcaaaacgagtgaatgaggtgattttaaATG

    kdtA --- lpxK Gene: kdtA     GI: 49475077     BI number: BH02660     GOG: COG1519     Description: 3-deoxy-d-manno-octulosonic-acid transferase Gene: lpxK     GI: 49475078     BI number: BH02670     GOG: COG1663     Description: Tetracyldisaccharide 4 27-kinas            aa           a  a            at            gt            cg            gc           c  a           a  a           t  |           a  |            at            at            at            at            at            gc           t  | aa       t  | a  a      c  | gt       t  | at       t  |        a gc       a  |      t  a gt       a  |      t  t at        at       t  t cg        at       t  c |  a       gc        gt a  a      a  |       at t  a       gc        gc c  a       gc        at ta        at       t  c ta       c  t       ta gt        at        ta ta        ta        cg c  c       cg        cg cg        ta        cg gc        tg        ta                         gagatttttttatttccaaaaatatgaagggtgttttgtgagataaaaaattgggtgcaatgaacagagttgataaattttttaacaaaagaagcttatagagacttcaaaacgagtgaatgaggtgattttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1519 3-deoxy-D-manno-octulosonic-acid transferase ... can be seen here [M] COG1663 Tetraacyldisaccharide-1-P 4'-kinase ... can be seen here     ..................................................................................................................