Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -4.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttagctggcaatggtcccatccaatgcgctttcgctgctattatggttttagcagcgggtgctggtattttctttgttgctaagcgctttcaggagtact
gtttatgatcttatggatgaaaaaaaatctgatgctaacaggtgcggttttagccgctttttttatagttttagccaaagctttcactcttggaaaaaag
gctgaacagcaaaagcaaacagaaaatattttaaagacaataacagcacggtttgaggtggaaaatgaagttaacaaaaaaactgatgttgatgtgcgtg
TTG

    BH02840


Gene: BH02840     GI: 49475089     BI number: BH02840     GOG: -------     Description: hypothetical protei


 tc
a  t
 gt
 ta
 at
 tg
 tg
 ta
 gt
|  g        c
|  a      g  t
|  a      t  a
t  a      a  a
c  a       gc
a  a       ta
t  a       cg
g  a       tg
a  a       at
 gt       a  g
 gc       a  c
 at       a  g       tt
 cg       a  g      t  a
 ta        at        tg
t  t       at        gc
t  |       at        gc
 cg        gt        cg
 gc        ta        gc
                        tttttttatagttttagccaaagctttcactcttggaaaaaaggctgaacagcaaaagcaaacagaaaatattttaaagacaataacagcacggtttgaggtggaaaatgaagttaacaaaaaaactgatgttgatgtgcgtgTTG


    ..................................................................................................................