                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:34 nt.    Distance to gene:39 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -6.20 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=34 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtcg-tacaat. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcgggtgtggttatgctatacaataccccttgggggaaagcataacgacggacttatcgccgtgtttttgagcacccggcactcttttatcgagtgt
caatcaaaaacatttaacgataaggagttctcATG

    BH03020 --- BH03010 Gene: BH03020     GI: 49475106     BI number: BH03020     GOG: -------     Description: Anti-repressor protein Gene: BH03010     GI: 49475105     BI number: BH03010     GOG: -------     Description: Anti-repressor protei tt c  g cg cg cg a  g t  a a  a a  |       ac c  |      g  t a  |      g  t t  |      c  a a  |       at ta        gc        tt cg        cg       t  g gc       a  c       ta ta       a  c       tg at        tg        gc ta        at        ta ta        cg        gc gc        gt       |  c g  g       at       |  c ta        at        cg gc        at        cg tg        gt        gc                         actcttttatcgagtgtcaatcaaaaacatttaacgataaggagttctcATG     ..................................................................................................................