                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agtattttaaatgcatgggagagatcttacgtgacctatccgctaatggtttagtgtttctagcacttgtgattcaggtaacatgagggtttattagtgt
caatatacttttaaaaaattatttcacatattgttgttttcaaaggatcgcatttgaaatgctaccctttactattcactcgcatttgaaatgcgagtga
accaaaatcctgatgatttgctgttttaaagggtgcgatttcaaatccaaccctcatttttccccattcatttctagccaatatttcaaaggagtataaa
ATG

    gpFI --- gpFII --- BH03070 Gene: gpFI     GI: 49475113     BI number: BH03090     GOG: COG3497     Description: Major tail sheath protein FI Gene: gpFII     GI: 49475112     BI number: BH03080     GOG: COG3498     Description: Major tail tube protein FII Gene: BH03070     GI: 49475111     BI number: BH03070     GOG: -------     Description: hypothetical prophage protei             g           t  c           t  t            tg            at            gt           |  t           t  t           a  a           g  a   g        ta t  a       cg         c ta        cg       t  a ta        tg        ta at        at        ta cg       a  g       at gc       a  c       gc cg       a  g      c  c ta       c  a      g  a cg       c  t       ta at        at        gc cg        at        gc ta        gc        gc ta        ta        at                         catttttccccattcatttctagccaatatttcaaaggagtataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3497 Phage tail sheath protein FI ... can be seen here [R] COG3498 Phage tail tube protein FII ... can be seen here     ..................................................................................................................